First report of nectarine virus M in grapefruit (

Causal Agent Citrus virus, marafivirus Crop Type Pathogen detection Subject Areas Tropical plants Viruses and viroids

Journal

Plant disease
ISSN: 0191-2917
Titre abrégé: Plant Dis
Pays: United States
ID NLM: 9882809

Informations de publication

Date de publication:
27 Jun 2024
Historique:
medline: 28 6 2024
pubmed: 28 6 2024
entrez: 28 6 2024
Statut: aheadofprint

Résumé

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Identifiants

pubmed: 38937932
doi: 10.1094/PDIS-05-24-1024-PDN
doi:

Types de publication

Journal Article

Langues

eng

Sous-ensembles de citation

IM

Auteurs

Avijit Roy (A)

USDA Agricultural Research Service, Molecular Plant Pathology Laboratory, Beltsville, Maryland, United States; avijit.roy@usda.gov.

Ashrafou Ouro-Djobo (A)

Texas A&M AgriLife Weslaco Research and Extension Center, Weslaco, Texas, United States; ashrafou.ouro-djobo@ag.tamu.edu.

Samuel Grinstead (S)

USDA ARS, Molecular Plant Pathology Laboratory, Beltsville, Maryland, United States; sam.grinstead@usda.gov.

John Hammond (J)

USDA-ARS, USNA, Floral and Nursery Plants Research Unit, 10300 Baltimore Avenue, B-010A, Beltsville, Maryland, United States, 20705; john.hammond@usda.gov.

Mamoudou Sétamou (M)

Texas A&M University, Kingsville Citrus Center, Department of Agriculture, Agribusiness, and Environmental Sciences, 312 N International Blvd, Citrus Center, Weslaco, Texas, United States, 78599.
Texas, United States; Mamoudou.Setamou@tamuk.edu.

Olufemi J Alabi (OJ)

Texas A&M AgriLife Weslaco Research and Extension Center, Department of Plant Pathology & Microbiology, Weslaco, Texas, United States; Olufemi.Alabi@ag.tamu.edu.

Classifications MeSH